Stable Transfection:Article Title: Viperin mutation is linked to immunity, immune cell dynamics, and metabolic alteration during VHSV infection in zebrafish
Article Snippet: After overnight culture, the vector was harvested using a plasmid extraction kit (Qiagen, Hilden, Germany). .. For stable cell preparation, vectors were linearized with the Bgl II restriction enzyme (Takara, Japan) and transfected into ZF4 cells (CRL-2050, ATCC, USA). .. Positive cells were selected based on Geneticin (Thermo Fisher Scientific, USA) resistance, and these positive colonies were expanded in L-15 growth medium supplemented with fetal bovine serum (FBS) 10%, 1% penicillin-streptomycin, and 1 mg/mL gentamycin.
Transfection:Article Title: Viperin mutation is linked to immunity, immune cell dynamics, and metabolic alteration during VHSV infection in zebrafish
Article Snippet: After overnight culture, the vector was harvested using a plasmid extraction kit (Qiagen, Hilden, Germany). .. For stable cell preparation, vectors were linearized with the Bgl II restriction enzyme (Takara, Japan) and transfected into ZF4 cells (CRL-2050, ATCC, USA). .. Positive cells were selected based on Geneticin (Thermo Fisher Scientific, USA) resistance, and these positive colonies were expanded in L-15 growth medium supplemented with fetal bovine serum (FBS) 10%, 1% penicillin-streptomycin, and 1 mg/mL gentamycin.
Plasmid Preparation:Article Title: Early Radial Extracorporeal Shockwave Stimulation on Proximal Tibial Circular Osteotomy Site Enhanced Heterotopic Skin Wound Healing via Small Extracellular Vesicles.
Article Snippet: .. The PCMV-N-Flag plasmid was linearized using Bgl II restriction enzyme (Takara, Japan). cDNAs for Lcp1, Thbs1, Cdc42, ILK, and Hspd1 (Miaoling Biology, Wuhan,China) were amplified by PCR using high-fidelity DNA polymerase (Takara) and gene-specific primers with homologous sequences for seamless cloning: Lcp1 (F: 5’-ATTCGATATCGTCGACAGATCTATGGCCAGAGGATCCGTGTC-3’, R: 5’-AGTTCTAGACTCGAGAGATCTTTACACCCTCTTCATCCCTTTC-3’), Thbs1 (F: 5’-ATTCGATATCGTCGACAGATCTATGGAGCTCCTCAGGGGACT-3’, R: 5’-AGTTCTAGACTCGAGAGATCTTTAGGAGTCTCGGCACTCGT-3’), Cdc42 (F: 5’-ATTCGATATCGTCGACAGATCTATGCAGACAATTAAGTGTGT-3’, R: 5’-AGTTCTAGACTCGAGAGATCTTCATAGCAGCACACACCTGC-3’), ILK (F: 5’-ATTCGATATCGTCGACAGATCTATGGACGACATTTTCACTCA-3’, R: 5’-AGTTCTAGACTCGAGAGATCTCTACTTGTCCTGCATCTTCT-3’), Hspd1 (F: 5’-ATTCGATATCGTCGACAGATCTATGCTTCGACTACCCACAGT-3’, R: 5’-AGTTCTAGACTCGAGAGATCTTTAGAACATGCCACCTCCCA-3’). .. PCR conditions were 98◦C for 30 s, 30 cycles of 98◦C for 10 s, 60◦C for 20 s, 72◦C for 30 s/kb, and 72◦C for 5 min. Purified PCR products and linearized plasmid were assembled using a seamless cloning kit (In-Fusion, Beyotime) at 50◦C for 15 min, transformed into DH5 α E. coli (AlpalifeBio, Guangdong, China), and selected on LB agar with 0.1% ampicillin (100 mg/mL, MCE, USA).
Article Title: Early Radial Extracorporeal Shockwave Stimulation on Proximal Tibial Circular Osteotomy Site Enhanced Heterotopic Skin Wound Healing via Small Extracellular Vesicles
Article Snippet: .. The PCMV‐N‐Flag plasmid was linearized using Bgl II restriction enzyme (Takara, Japan). cDNAs for Lcp1, Thbs1, Cdc42, ILK, and Hspd1 (Miaoling Biology, Wuhan,China) were amplified by PCR using high‐fidelity DNA polymerase (Takara) and gene‐specific primers with homologous sequences for seamless cloning: Lcp1 (F: 5'‐ATTCGATATCGTCGACAGATCTATGGCCAGAGGATCCGTGTC‐3', R: 5'‐AGTTCTAGACTCGAGAGATCTTTACACCCTCTTCATCCCTTTC‐3'), Thbs1 (F: 5'‐ATTCGATATCGTCGACAGATCTATGGAGCTCCTCAGGGGACT‐3', R: 5'‐AGTTCTAGACTCGAGAGATCTTTAGGAGTCTCGGCACTCGT‐3'), Cdc42 (F: 5'‐ATTCGATATCGTCGACAGATCTATGCAGACAATTAAGTGTGT‐3', R: 5'‐AGTTCTAGACTCGAGAGATCTTCATAGCAGCACACACCTGC‐3'), ILK (F: 5'‐ATTCGATATCGTCGACAGATCTATGGACGACATTTTCACTCA‐3', R: 5'‐AGTTCTAGACTCGAGAGATCTCTACTTGTCCTGCATCTTCT‐3'), Hspd1 (F: 5'‐ATTCGATATCGTCGACAGATCTATGCTTCGACTACCCACAGT‐3', R: 5'‐AGTTCTAGACTCGAGAGATCTTTAGAACATGCCACCTCCCA‐3'). .. PCR conditions were 98°C for 30 s, 30 cycles of 98°C for 10 s, 60°C for 20 s, 72°C for 30 s/kb, and 72°C for 5 min. Purified PCR products and linearized plasmid were assembled using a seamless cloning kit (In‐Fusion, Beyotime) at 50°C for 15 min, transformed into DH5α E. coli (AlpalifeBio, Guangdong, China), and selected on LB agar with 0.1% ampicillin (100 mg/mL, MCE, USA).
Amplification:Article Title: Early Radial Extracorporeal Shockwave Stimulation on Proximal Tibial Circular Osteotomy Site Enhanced Heterotopic Skin Wound Healing via Small Extracellular Vesicles.
Article Snippet: .. The PCMV-N-Flag plasmid was linearized using Bgl II restriction enzyme (Takara, Japan). cDNAs for Lcp1, Thbs1, Cdc42, ILK, and Hspd1 (Miaoling Biology, Wuhan,China) were amplified by PCR using high-fidelity DNA polymerase (Takara) and gene-specific primers with homologous sequences for seamless cloning: Lcp1 (F: 5’-ATTCGATATCGTCGACAGATCTATGGCCAGAGGATCCGTGTC-3’, R: 5’-AGTTCTAGACTCGAGAGATCTTTACACCCTCTTCATCCCTTTC-3’), Thbs1 (F: 5’-ATTCGATATCGTCGACAGATCTATGGAGCTCCTCAGGGGACT-3’, R: 5’-AGTTCTAGACTCGAGAGATCTTTAGGAGTCTCGGCACTCGT-3’), Cdc42 (F: 5’-ATTCGATATCGTCGACAGATCTATGCAGACAATTAAGTGTGT-3’, R: 5’-AGTTCTAGACTCGAGAGATCTTCATAGCAGCACACACCTGC-3’), ILK (F: 5’-ATTCGATATCGTCGACAGATCTATGGACGACATTTTCACTCA-3’, R: 5’-AGTTCTAGACTCGAGAGATCTCTACTTGTCCTGCATCTTCT-3’), Hspd1 (F: 5’-ATTCGATATCGTCGACAGATCTATGCTTCGACTACCCACAGT-3’, R: 5’-AGTTCTAGACTCGAGAGATCTTTAGAACATGCCACCTCCCA-3’). .. PCR conditions were 98◦C for 30 s, 30 cycles of 98◦C for 10 s, 60◦C for 20 s, 72◦C for 30 s/kb, and 72◦C for 5 min. Purified PCR products and linearized plasmid were assembled using a seamless cloning kit (In-Fusion, Beyotime) at 50◦C for 15 min, transformed into DH5 α E. coli (AlpalifeBio, Guangdong, China), and selected on LB agar with 0.1% ampicillin (100 mg/mL, MCE, USA).
Article Title: Early Radial Extracorporeal Shockwave Stimulation on Proximal Tibial Circular Osteotomy Site Enhanced Heterotopic Skin Wound Healing via Small Extracellular Vesicles
Article Snippet: .. The PCMV‐N‐Flag plasmid was linearized using Bgl II restriction enzyme (Takara, Japan). cDNAs for Lcp1, Thbs1, Cdc42, ILK, and Hspd1 (Miaoling Biology, Wuhan,China) were amplified by PCR using high‐fidelity DNA polymerase (Takara) and gene‐specific primers with homologous sequences for seamless cloning: Lcp1 (F: 5'‐ATTCGATATCGTCGACAGATCTATGGCCAGAGGATCCGTGTC‐3', R: 5'‐AGTTCTAGACTCGAGAGATCTTTACACCCTCTTCATCCCTTTC‐3'), Thbs1 (F: 5'‐ATTCGATATCGTCGACAGATCTATGGAGCTCCTCAGGGGACT‐3', R: 5'‐AGTTCTAGACTCGAGAGATCTTTAGGAGTCTCGGCACTCGT‐3'), Cdc42 (F: 5'‐ATTCGATATCGTCGACAGATCTATGCAGACAATTAAGTGTGT‐3', R: 5'‐AGTTCTAGACTCGAGAGATCTTCATAGCAGCACACACCTGC‐3'), ILK (F: 5'‐ATTCGATATCGTCGACAGATCTATGGACGACATTTTCACTCA‐3', R: 5'‐AGTTCTAGACTCGAGAGATCTCTACTTGTCCTGCATCTTCT‐3'), Hspd1 (F: 5'‐ATTCGATATCGTCGACAGATCTATGCTTCGACTACCCACAGT‐3', R: 5'‐AGTTCTAGACTCGAGAGATCTTTAGAACATGCCACCTCCCA‐3'). .. PCR conditions were 98°C for 30 s, 30 cycles of 98°C for 10 s, 60°C for 20 s, 72°C for 30 s/kb, and 72°C for 5 min. Purified PCR products and linearized plasmid were assembled using a seamless cloning kit (In‐Fusion, Beyotime) at 50°C for 15 min, transformed into DH5α E. coli (AlpalifeBio, Guangdong, China), and selected on LB agar with 0.1% ampicillin (100 mg/mL, MCE, USA).
Polymerase Chain Reaction:Article Title: Early Radial Extracorporeal Shockwave Stimulation on Proximal Tibial Circular Osteotomy Site Enhanced Heterotopic Skin Wound Healing via Small Extracellular Vesicles.
Article Snippet: .. The PCMV-N-Flag plasmid was linearized using Bgl II restriction enzyme (Takara, Japan). cDNAs for Lcp1, Thbs1, Cdc42, ILK, and Hspd1 (Miaoling Biology, Wuhan,China) were amplified by PCR using high-fidelity DNA polymerase (Takara) and gene-specific primers with homologous sequences for seamless cloning: Lcp1 (F: 5’-ATTCGATATCGTCGACAGATCTATGGCCAGAGGATCCGTGTC-3’, R: 5’-AGTTCTAGACTCGAGAGATCTTTACACCCTCTTCATCCCTTTC-3’), Thbs1 (F: 5’-ATTCGATATCGTCGACAGATCTATGGAGCTCCTCAGGGGACT-3’, R: 5’-AGTTCTAGACTCGAGAGATCTTTAGGAGTCTCGGCACTCGT-3’), Cdc42 (F: 5’-ATTCGATATCGTCGACAGATCTATGCAGACAATTAAGTGTGT-3’, R: 5’-AGTTCTAGACTCGAGAGATCTTCATAGCAGCACACACCTGC-3’), ILK (F: 5’-ATTCGATATCGTCGACAGATCTATGGACGACATTTTCACTCA-3’, R: 5’-AGTTCTAGACTCGAGAGATCTCTACTTGTCCTGCATCTTCT-3’), Hspd1 (F: 5’-ATTCGATATCGTCGACAGATCTATGCTTCGACTACCCACAGT-3’, R: 5’-AGTTCTAGACTCGAGAGATCTTTAGAACATGCCACCTCCCA-3’). .. PCR conditions were 98◦C for 30 s, 30 cycles of 98◦C for 10 s, 60◦C for 20 s, 72◦C for 30 s/kb, and 72◦C for 5 min. Purified PCR products and linearized plasmid were assembled using a seamless cloning kit (In-Fusion, Beyotime) at 50◦C for 15 min, transformed into DH5 α E. coli (AlpalifeBio, Guangdong, China), and selected on LB agar with 0.1% ampicillin (100 mg/mL, MCE, USA).
Article Title: Early Radial Extracorporeal Shockwave Stimulation on Proximal Tibial Circular Osteotomy Site Enhanced Heterotopic Skin Wound Healing via Small Extracellular Vesicles
Article Snippet: .. The PCMV‐N‐Flag plasmid was linearized using Bgl II restriction enzyme (Takara, Japan). cDNAs for Lcp1, Thbs1, Cdc42, ILK, and Hspd1 (Miaoling Biology, Wuhan,China) were amplified by PCR using high‐fidelity DNA polymerase (Takara) and gene‐specific primers with homologous sequences for seamless cloning: Lcp1 (F: 5'‐ATTCGATATCGTCGACAGATCTATGGCCAGAGGATCCGTGTC‐3', R: 5'‐AGTTCTAGACTCGAGAGATCTTTACACCCTCTTCATCCCTTTC‐3'), Thbs1 (F: 5'‐ATTCGATATCGTCGACAGATCTATGGAGCTCCTCAGGGGACT‐3', R: 5'‐AGTTCTAGACTCGAGAGATCTTTAGGAGTCTCGGCACTCGT‐3'), Cdc42 (F: 5'‐ATTCGATATCGTCGACAGATCTATGCAGACAATTAAGTGTGT‐3', R: 5'‐AGTTCTAGACTCGAGAGATCTTCATAGCAGCACACACCTGC‐3'), ILK (F: 5'‐ATTCGATATCGTCGACAGATCTATGGACGACATTTTCACTCA‐3', R: 5'‐AGTTCTAGACTCGAGAGATCTCTACTTGTCCTGCATCTTCT‐3'), Hspd1 (F: 5'‐ATTCGATATCGTCGACAGATCTATGCTTCGACTACCCACAGT‐3', R: 5'‐AGTTCTAGACTCGAGAGATCTTTAGAACATGCCACCTCCCA‐3'). .. PCR conditions were 98°C for 30 s, 30 cycles of 98°C for 10 s, 60°C for 20 s, 72°C for 30 s/kb, and 72°C for 5 min. Purified PCR products and linearized plasmid were assembled using a seamless cloning kit (In‐Fusion, Beyotime) at 50°C for 15 min, transformed into DH5α E. coli (AlpalifeBio, Guangdong, China), and selected on LB agar with 0.1% ampicillin (100 mg/mL, MCE, USA).
Cloning:Article Title: Early Radial Extracorporeal Shockwave Stimulation on Proximal Tibial Circular Osteotomy Site Enhanced Heterotopic Skin Wound Healing via Small Extracellular Vesicles.
Article Snippet: .. The PCMV-N-Flag plasmid was linearized using Bgl II restriction enzyme (Takara, Japan). cDNAs for Lcp1, Thbs1, Cdc42, ILK, and Hspd1 (Miaoling Biology, Wuhan,China) were amplified by PCR using high-fidelity DNA polymerase (Takara) and gene-specific primers with homologous sequences for seamless cloning: Lcp1 (F: 5’-ATTCGATATCGTCGACAGATCTATGGCCAGAGGATCCGTGTC-3’, R: 5’-AGTTCTAGACTCGAGAGATCTTTACACCCTCTTCATCCCTTTC-3’), Thbs1 (F: 5’-ATTCGATATCGTCGACAGATCTATGGAGCTCCTCAGGGGACT-3’, R: 5’-AGTTCTAGACTCGAGAGATCTTTAGGAGTCTCGGCACTCGT-3’), Cdc42 (F: 5’-ATTCGATATCGTCGACAGATCTATGCAGACAATTAAGTGTGT-3’, R: 5’-AGTTCTAGACTCGAGAGATCTTCATAGCAGCACACACCTGC-3’), ILK (F: 5’-ATTCGATATCGTCGACAGATCTATGGACGACATTTTCACTCA-3’, R: 5’-AGTTCTAGACTCGAGAGATCTCTACTTGTCCTGCATCTTCT-3’), Hspd1 (F: 5’-ATTCGATATCGTCGACAGATCTATGCTTCGACTACCCACAGT-3’, R: 5’-AGTTCTAGACTCGAGAGATCTTTAGAACATGCCACCTCCCA-3’). .. PCR conditions were 98◦C for 30 s, 30 cycles of 98◦C for 10 s, 60◦C for 20 s, 72◦C for 30 s/kb, and 72◦C for 5 min. Purified PCR products and linearized plasmid were assembled using a seamless cloning kit (In-Fusion, Beyotime) at 50◦C for 15 min, transformed into DH5 α E. coli (AlpalifeBio, Guangdong, China), and selected on LB agar with 0.1% ampicillin (100 mg/mL, MCE, USA).
Article Title: Early Radial Extracorporeal Shockwave Stimulation on Proximal Tibial Circular Osteotomy Site Enhanced Heterotopic Skin Wound Healing via Small Extracellular Vesicles
Article Snippet: .. The PCMV‐N‐Flag plasmid was linearized using Bgl II restriction enzyme (Takara, Japan). cDNAs for Lcp1, Thbs1, Cdc42, ILK, and Hspd1 (Miaoling Biology, Wuhan,China) were amplified by PCR using high‐fidelity DNA polymerase (Takara) and gene‐specific primers with homologous sequences for seamless cloning: Lcp1 (F: 5'‐ATTCGATATCGTCGACAGATCTATGGCCAGAGGATCCGTGTC‐3', R: 5'‐AGTTCTAGACTCGAGAGATCTTTACACCCTCTTCATCCCTTTC‐3'), Thbs1 (F: 5'‐ATTCGATATCGTCGACAGATCTATGGAGCTCCTCAGGGGACT‐3', R: 5'‐AGTTCTAGACTCGAGAGATCTTTAGGAGTCTCGGCACTCGT‐3'), Cdc42 (F: 5'‐ATTCGATATCGTCGACAGATCTATGCAGACAATTAAGTGTGT‐3', R: 5'‐AGTTCTAGACTCGAGAGATCTTCATAGCAGCACACACCTGC‐3'), ILK (F: 5'‐ATTCGATATCGTCGACAGATCTATGGACGACATTTTCACTCA‐3', R: 5'‐AGTTCTAGACTCGAGAGATCTCTACTTGTCCTGCATCTTCT‐3'), Hspd1 (F: 5'‐ATTCGATATCGTCGACAGATCTATGCTTCGACTACCCACAGT‐3', R: 5'‐AGTTCTAGACTCGAGAGATCTTTAGAACATGCCACCTCCCA‐3'). .. PCR conditions were 98°C for 30 s, 30 cycles of 98°C for 10 s, 60°C for 20 s, 72°C for 30 s/kb, and 72°C for 5 min. Purified PCR products and linearized plasmid were assembled using a seamless cloning kit (In‐Fusion, Beyotime) at 50°C for 15 min, transformed into DH5α E. coli (AlpalifeBio, Guangdong, China), and selected on LB agar with 0.1% ampicillin (100 mg/mL, MCE, USA).
Southern Blot:Article Title: Overexpression of a Eutrema salsugineum phosphate transporter gene EsPHT1;4 enhances tolerance to low phosphorus stress in soybean.
Article Snippet: Objective To enhance Pi absorption and utilization efficiency of soybean, a member of PHT1 gene family was isolated and characterized from E. salsugineum, which was a homologous gene of AtPHT1;4 and consequently designated as EsPHT1;4.. Results Quantitative real-time PCR (qRT-PCR) analysis showed that the transcript level of EsPHT1;4 significantly increased both in roots and leaves of E. salsugineum under Pi deficient conditions.. Furthermore, EsPHT1;4 was transferred to soybean cultivar ‘‘YD22’’ using an Agrobacterium-mediated cotyledonary-node transformation method.
Hybridization:Article Title: Overexpression of a Eutrema salsugineum phosphate transporter gene EsPHT1;4 enhances tolerance to low phosphorus stress in soybean.
Article Snippet: Objective To enhance Pi absorption and utilization efficiency of soybean, a member of PHT1 gene family was isolated and characterized from E. salsugineum, which was a homologous gene of AtPHT1;4 and consequently designated as EsPHT1;4.. Results Quantitative real-time PCR (qRT-PCR) analysis showed that the transcript level of EsPHT1;4 significantly increased both in roots and leaves of E. salsugineum under Pi deficient conditions.. Furthermore, EsPHT1;4 was transferred to soybean cultivar ‘‘YD22’’ using an Agrobacterium-mediated cotyledonary-node transformation method.
Transgenic Assay:Article Title: Overexpression of a Eutrema salsugineum phosphate transporter gene EsPHT1;4 enhances tolerance to low phosphorus stress in soybean.
Article Snippet: Objective To enhance Pi absorption and utilization efficiency of soybean, a member of PHT1 gene family was isolated and characterized from E. salsugineum, which was a homologous gene of AtPHT1;4 and consequently designated as EsPHT1;4.. Results Quantitative real-time PCR (qRT-PCR) analysis showed that the transcript level of EsPHT1;4 significantly increased both in roots and leaves of E. salsugineum under Pi deficient conditions.. Furthermore, EsPHT1;4 was transferred to soybean cultivar ‘‘YD22’’ using an Agrobacterium-mediated cotyledonary-node transformation method.
|
TaKaRa is a verified supplier 
TaKaRa manufactures this product 